PESQUISA

Participe da votação sobre os melhores canais de divulgação científica em português na internet.

sexta-feira, 22 de junho de 2012

Jogo dos erros 5

Claudio Angelo, da Folha de São Paulo, cantou a bola, uma onda negacionista estava por vir. Veio. No Brasil, foi uma entrevista no programa do Jô, uma carta dos negacionistas, uma série de reportagens no Jornal da Band, uma no Jornal Nacional, um debate no Entre Aspas da Globo News e várias reportagens na mídia impressa.

Quem vem à carga agora é um colunista da Folha de São Paulo, o engenheiro-civil e de petróleo Rodolfo Landim: "Influência humana em mudanças climáticas é discutível".

É discutível apenas no sentido de que, como toda hipótese científica, é aberta à discussão e à contestação. Mas não no sentido que ele quer passar: de que as bases factuais em apoio sejam suspeitas e fracas.

"Há uma clara divisão de opiniões sobre o tema: existe um grupo de cientistas que acredita que o comportamento da humanidade nos coloca a caminho de grandes desastres, enquanto outros defendem que o aquecimento global que estamos vivenciando é apenas parte de um processo cíclico que vem ocorrendo na face da Terra ao longo dos últimos milhares de anos."
De fato, a divisão é relativamente clara no sentido de que é mais ou menos fácil de se distinguir membros de um grupo do de outro*. Mas não no sentido que invoca: de que a divisão separa em grupos mais ou menos equivalentes. A divisão não é equivalente nem numericamente (alhures mostro como a visão de que não há influência humana significativa é minoritária entre os especialistas: só 6% dos membros da Associação Meteorológica acreditam que o aquecimento não é antropogênico em nenhuma extensão e 82% dos cientistas da Terra concordam que há aquecimento e os humanos têm um papel nisso), nem - o que realmente importa - em termos de embasamento factual, os melhores indícios disponíveis apontam para o aquecimento global antropogênico (como mostro na série sobre o AGA e outras postagens compiladas aqui).

O que o colunista diz é o equivalente a dizer que há uma clara divisão de opiniões sobre a evolução biológica - existe um grupo de cientistas que acredita que a vida evoluiu, enquanto outros que ela surgiu mais ou menos da mesma forma que se encontra atualmente, ou que há uma clara divisão entre os cientistas que acreditam que a Aids é causada pelo HIV e os que acham que é por outra coisa.

"Os impactos causados pelo lançamento de compostos de carbono de origem humana na atmosfera afetariam apenas os locais onde eles se situam, ou, no máximo, o seu entorno, e sem nenhuma expressão em termos de abrangência global."
O colunista deve achar que a atmosfera é uma coisa estática, que não há mistura gasosa - fora isso verdade, as cidades morreriam sufocadas sem oxigênio (localmente não é produzido quase nenhum). Também deve achar que na Antárctica tem fábricas de CFCs.

"Toda a energia consumida pela humanidade por dia equivale a sete milésimos da que o nosso planeta recebe do Sol no mesmo período."
Verdade. Mas completamente irrelevante para a questão. Nenhum modelo que indica a AGA diz que o aquecimento se deve à introdução de mais energia no sistema pela energia consumida pelos seres humanos. A questão é a mudança na composição atmosférica que leva a uma maior captura da energia solar (na verdade, a uma menor saída de energia solar na faixa do infravermelho).

"Em recente carta enviada à Presidência da República, um grupo de renomados cientistas brasileiros de algumas das mais importantes instituições do país (como USP, UFRJ, Inpe, ITA, Unesp e CPRM), formado por geólogos, geógrafos, físicos, meteorologistas, engenheiros e ambientalistas, defenderam essa visão de forma clara e objetiva."
Aceitemos que seja de forma clara e objetiva. Mas foi de uma forma clara, objetiva e errada.

"Considerando apenas o período dos últimos 20 mil anos, ou seja, a partir do início do degelo da última glaciação, as evidências geológicas demonstram ter havido períodos em que as variações de temperatura e do nível do mar foram várias vezes maiores que no período de 1.850 a 2.000, pós-Revolução Industrial, quando a temperatura subiu 0,74ºC (grau centígrado) e o mar subiu 20 centímetros."
Deveria considerar também que a variação foi em cima do último máximo *glacial*. O aumento de 0,74ºC e 20 cm observados entre 1850 e 2000 foi em cima já de um nível aumentado. Se as temperaturas globais médias tivessem partido da temperatura equivalente do último máximo glacial - alguma coisa como 10ºC menos do que hoje - aí, sim, não deveríamos nos preocupar com o aquecimento atual. Mas sair de uma temperatura média de 14ºC para 16ºC ou mais provavelmente não será uma boa ideia.

A ideia sugerida de que a variação atual estaria dentro da variação observada anteriormente e, portanto, que isso indicaria causas naturais, não se sustenta pelos indícios a favor da hipótese do AGA. O que essa variação mostra é que a temperatura da Terra tem seguido muito de perto os níveis de CO2 na atmosfera (Figura 1 e 2*).

Figura 1. Correlação da concentração atmosférica de CO2 e a temperatura. Fontes: CDIAC, concentração de CO2 em Vostok/Antártica; NOAA, temperatura na Groenlândia. (Nota: a concentração de CO2 usada foi a média para as idades imediatamente anterior e posterior correspondentes às datas para as temperaturas.)


Figura 2. Evolução da temperatura atmosférica (Groenlândia) - em  ºC - e da concentração atmosférica de CO2 (Vostok/Antárctica) - em ppmv. Fontes: CDIAC, concentração de CO2 em Vostok/Antártica; NOAA, temperatura na Groenlândia.*

"A 'descarbonização' da economia seria desnecessária e contraproducente por buscar uma pseudosolução para um problema inexistente, já que, além de não implicar nenhum efeito palpável sobre o clima, levaria ao encarecimento das tarifas de energia pelo uso de outras fontes alternativas mais caras ou subsidiadas, cujos recursos poderiam ser mais bem direcionados."
Dá para responder em duas palavras: wishful thinking. Vamos voltar para a hipótese do gajo de que os problemas do carbono lançados na atmosfera seriam apenas locais. Vamos, por caridade, considerar tal hipótese verdadeira, então, como assim, desnecessária? A poluição nas cidades não é um fato? Não temos problemas com chuva ácida (pelo enxofre presente nos combustíveis fósseis), fuligem, monóxido de carbono?

"Assim, a humanidade, que hoje detém um enorme acervo de conhecimentos e recursos técnicos e humanos, deveria deixar de lado o alarmismo climático e dirigir seu foco para viabilizar de forma sustentável a universalização de melhores níveis de bem-estar por meio de obras de infraestrutura de água, saneamento, transportes, comunicação, serviços de educação e saúde e prover eletricidade a mais de 1,5 bilhão de pessoas hoje desassistidas."
Há concordância quanto aos problemas do alarmismo climático e há concordância em relação às necessidades de desenvolvimento sustentável (tanto é que é dos poucos pontos que ficaram no texto base para a discussão dos chefes de estado na Rio+20). O problema é que não se pode negligenciar as mudanças climáticas sob o risco desse bem estar se perder, afetando-se, entre outras coisas, as infraestruturas, a produção de alimentos e acesso à água.

-----
*Obs: Só mais ou menos porque se descermos aos detalhes, a divisão não é tão nítida assim: por exemplo, há os que acham que não ocorrem aquecimento algum; há os que acham que há aquecimento, mas os humanos não têm influência nenhuma; há os que acham que os humanos estão causando um aquecimento global, mas que isso é benéfico e por aí vai. Para complicar um pouco mais, há os que oscilam entre as diferentes posições.

Upideite(22/jun/2012): Carlos Orsi tem uma postagem analisando a estrutura geral dos argumentos negacionistas.
*Upideite(23/jun/2012): Adido a esta data.

sábado, 16 de junho de 2012

Causo: Qual a diferença entre a Science e a Nature? Perspectiva de um percevejo.

"Everything has already been said, but perhaps not by everyone and to everyone."
["Tudo já foi dito, mas talvez não por todos e nem pra todo mundo."]
Desconhecido.  Apud  DiNardo 2008.

As duas principais revistas científicas multitemáticas são a britânica Nature (fundada em 1869 e com assinatura anual de US$ 199) e a americana Science (em 1880, com assinatura anual de US$ 140). A primeira tem um fator de impacto de 36,101 citações por artigos e a segunda, de 31,364 (valores de 2010). Ambas receberam em 2007, o prêmio Príncipe das Astúrias na categoria de comunicação.

Mas tirando o fato de que na primeira você escreveria 'organisation' e na segunda, 'organization', que diferenças substanciais podemos destacar entre as duas? Um inseto, o percevejo-fogo europeu Pyrrhocoris apterus, sabe. (Figuras 1, adulto, e 2, ninfa.)

Figura 1. Adulto de Pyrrhocoris apterus. Fonte: Wikimedia Commons.


Figura 2. Ninfa de Pyrrhocoris apterus. Fonte: Wikimedia Commons.


A história - publicada em 1965 - é antiga o bastante para ter adentrado em livros-textos de fisiologia animal e biologia do desenvolvimento, mas a anedota é suficientemente deliciosa e dentro de um tema não tão bem profundamente conhecido pelo público em geral que vale a pena contar.

O fisiologista animal tcheco Karel Sláma, do então Instituto Entomológico da Academia de Ciências Tchecoslovaca (atualmente da Academia de Ciências da República Tcheca), foi visitar os EUA e levou ovos do P. apterus para o laboratório de Carroll Milton Williams (morto em 1991, aos 74), entomólogo da Universidade de Harvard. (Não sei como era naquele tempo a questão da defesa agropecuária e introdução de pragas em potencial. Provavelmente bem menos rigoroso do que hoje em dia.)

Como todo bom hemimetábolo, o P. apterus normalmente passa por estágios de ninfas, sofrendo muda periódica e, ao final, adquirindo a asa da forma adulta. Esse processo é controlado pelo hormônio juvenilizante, secretado pelas corpora alatta, um par de glândulas localizadas atrás do cérebro dos insetos. Após algumas mudas, o hormônio deixa de ser produzido pelas glândulas e o inseto se transforma em adulto (voltando a ser produzido e estimulando a maturação das gônadas).

Nos 10 anos em que foram criadas no laboratório em Praga, as linhagens apresentaram todas desenvolvimento normal dos indivíduos, com o estágio adulto ocorrendo na muda do 5o estágio de ninfa. Em Boston, dos 1.500 ovos que eclodiram inicialmente, nenhum alcançou a maturidade sexual: a partir do 5o estágio, emergiu um 6o estágio de ninfa ou formas adultóides que retinham muitas características larvais; em alguns casos, houve até mesmo um 7o estágio de ninfa.

Após uma detalhada auditoria comparando as diferenças de manejo das criações no laboratório de Praga e no de Harvard, chegaram a uma lista de 15 diferenças. Uma a uma foram testadas. A conclusão foi a de que o papel toalha usado para forrar as caixas de criação estava envolvido: quando o substituíram por um papel filtro, o fenômeno desapareceu.

Abriu-se uma avenida de possibilidades para os cientistas explorarem. Experimentaram diferentes marcas de papel toalha: 18 das 20 testadas causavam a juvenilização permanente dos insetos. Exposição a exemplares de The Wall Street Journal, New York Times, Boston Globe, Scientific American e... Science também provocavam o fenômeno. Mas, se usavam papel de procedência europeia e japonesa, não. Nem London Times, nem... Nature.

Isolando extratos dos papéis e depois das árvores fonte das fibras chegaram à conclusão de que um composto presente naturalmente em certas plantas americanas mimetizava o efeito do hormônio juvenilizante de P. apterus. E o efeito era bem específico - pois os extratos que tinham o efeito no percevejo não causavam nenhum sinal quando aplicado em pupas de Hyalophora cecropia e de Antheraea polyphemus, dois lepidópteros saturnídeos norte-americanos.

Estava descoberto um novo mecanismo de proteção de plantas. E, claro, um novo caminho para controle de pragas.

Upideite(16/jun/2012): De mais peculiar no artigo, é que lá há menos preocupação com descrições quantitativas, tabelas e gráficos sobre os resultados, do que a descrição do processo: desde como o problema surgiu, até os caminhos pelos quais a questão foi atacada. Claro, inevitavelmente a narrativa é direcionada pela trilha que, ao fim, revelou-se esclarecedora - mas há pistas dos outros desvios percorridos. A maioria dos trabalhos falham em contextualizar o processo - quando muito, a origem da questão é colocada na introdução; mas do resto decorre uma descrição que parece que os autores tinham a exata ideia do que deveria ser feito desde o início e que tudo se deu exatamente como planejado. Acho que entre os materiais suplementares disponibilizados nos sites de muitos periódicos (com detalhamento da metodologia, dos dados analisados, gráficos que não couberam no artigo final, etc.) poderia constar uma breve narrativa dos caminhos geralmente tortuosos trilhados pelos pesquisadores. Ou pelo menos um link para uma página (ou blogue) em que os autores dão detalhes dos impasses e insights surgidos.

sexta-feira, 8 de junho de 2012

Especulando: Somos vírus?

ATENÇÃO: Os fatos contrários às teses aqui apresentadas não foram exaustivamente analisados, nem as ideias gerais foram adequadamente submetidas a testes rigorosos de hipótese. Os quadros apresentados abaixo são uma especulação com fins unicamente de provocação.
---------------
"They're us. We're them and they're us."
["Eles somos nós. Nós somos eles e eles somos nós."]

"It came to me when I tried to classify your species and I realized that you're not actually mammals. [...] Do you know what it is? A virus."
["Isso veio, enquanto tentava classificar sua espécie e descobri que vocês não são na verdade mamíferos. [...] Você sabe o que é isso? Um vírus."]
Agent Smith, Matrix, 1999

Por definição, não temos como ser vírus. Vírus podem ser definidos como entidades codificantes de capsídeo: compostas de proteínas e ácidos nucleicos que se auto-organizam em nucleocapsídeos e se valem de organismos codificadores de ribossomos para se reproduzir (Raoult & Forterre 2008).

Mas para além da definição estrita, como um grupo, podem ter desempenhado papel crucial na evolução dos organismos celulares, incluindo sua origem.

Três grandes classes de hipóteses para a origem dos vírus são defendidas na literatura (Claverie 2006, Forterre 2006,  Wessner 2010):
a) Vírus primeiro ou coevolução: vírus ou elementos genéticos egoístas existiriam no ambiente do Mundo de ARN, parasitando, não células, mas os próprios sistemas genéticos (ou a "sopa primitiva") como hospedeiros;
b) Escape, errância ou hipótese progressiva: elementos genéticos móveis das células adquiririam elementos como a formação de capsídios permitindo sair das células e infectar outras;
c) Redução, degeneração ou hipótese regressiva: célula parasita intracelular perderia, ao longo de sua evolução, toda sua maquinaria replicativa, valendo-se totalmente da do hospedeiro.

Forterre (2006) especula que os vírus de ARN teriam se originado no Mundo de Nucleoproteínas a partir do escape ou redução de células de ARN, enquanto os vírus de ADN teriam se originado diretamente de vírus de ARN. Ele descarta a hipótese do vírus primeiro a partir do fato de todos os vírus atuais, incluindo viroides (moléculas infecciosas de ARN sem capsídios), serem parasitas intracelulares - os vírus são dependentes de ribossomos para sua reprodução e os viroides dependem de um ambiente que forneça nucleotídeos para sua síntese. Na opinião do autor, tais condições dificilmente ocorreriam em um ambiente com moléculas livres na solução. Mas os vírus seriam de origem antiga e não resultado de escapes ou reduções mais recentes pelo fato de as proteínas de transcrição, replicação, recombinação e reparo (proteínas informacionais) serem bastante distintas na sequência em relações a proteínas que desempenham o mesmo papel em seus hospedeiros.

Koonin et al.(2006) defendem a hipótese do vírus primeiro. Em sua análise, os diferentes grupos de vírus compartilham um conjunto de genes com fortes indicações de monofiletismo e apenas distantemente relacionados a genes presentes nos organismos celulares - que os autores chamam de "genes de marca virótica" ("viral hallmark genes"). Duas proteínas virais, não compartilhadas com organismos celulares, estão presentes nos diferentes grupos de vírus (embora não em todos os membros de cada grupo): a proteína de capsídio de topologia de rocambole ("jelly-roll capsid protein" JRC) e as helicases da superfamília 3 (S3H). O fato de esses genes de marca virótica serem em número reduzido, com espalhamento em mosaico entre os membros dos diferentes grupos de vírus indicariam que os vírus em si não seriam um grupo monofilético; por outro lado, não seria o caso de compartilhamento por transferência horizontal por conta da grande divergência na sequência dos genes entre os diferentes grupos de vírus. Seriam, então, originários diretamente da sopa de genes que antedatam a emergência das células.

Para Forterre (2006), as primeiras células teriam genomas baseados em ARN pelo fato de as bactérias e arqueas/eucariotos atuais possuírem sistemas de replicação de ADN totalmente diferentes: assim, o genoma de ADN teria surgido de modo independente nas duas linhagens a partir do ancestral. A evitação de sistemas de degradação de ARN parasítico, via nucleases e ARN de interferência, em células primitivas de ARN teria sido a pressão seletiva que levou ao surgimento de vírus de ADN. A emergência ou recrutamento de atividade de redutase de ribonucleotídeo produziria um genoma de ADN com uracila (ADN-U) - alguns bacteriófagos atuais têm genomas de ADN-U e poderiam ser relictos dessa transição. (Outras linhagens virais desenvolveram sistemas diversos de evitação da degradação, como metilação de nucleotídeos e inibidores de nucleases, conservando o genoma de ARN.) O surgimento da atividade de sintase de timidilato em algumas linhagens produziu genomas de ADN modernos, com timina no lugar de uracila (ADN-T). (Essa transição deve ter ocorrido pelo menos duas vezes, já que há duas sintases de timidilato não-homólogas entre os vírus atuais.) A tecnologia de produção de ADN dos vírus teria sido adquirida, de modo independente, pelo ancestral das bactérias e pelo dos arqueas/eucariotos - isso explicaria as diferenças nas proteínas de replicação do ADN nesses dois grupos (essa aquisição pode ter ocorrido três vezes, uma vez para cada ancestral de cada domínio - por conta de diferenças na topoisomerase e polimerases entre arqueas e eucariotos). O ADN sendo mais estável do que o ARN, pela perda de oxigênio reativo na posição 2' da ribose, e permitindo o reconhecimento pelo sistema de reparo da alteração da citosina à uracila (causada pela desaminação espontânea) permitiria nos ancestrais dos organismos celulares o desenvolvimento de um genoma maior e mais complexo.

Koonin et al. (2006) contestam a hipótese do ancestral celular com genoma de ARN pelo fato de o conjunto mínimo de genes necessários para uma célula funcional ser relativamente grande: da ordem de algumas centenas. A instabilidade das moléculas de ARN exigiria que tal genoma consistisse em moléculas distintas de ARN também nessa ordem de modo que fossem pequenas o suficiente para garantir uma replicação acurada. Isso, porém, levantaria uma questão de como as células filhas receberiam pelo menos uma cópia de cada molécula - seria necessário um sistema altamente acurado de segregação de moléculas de ARN. Além disso, se o sistema de produção de ADN das células tivesse sido recrutado a partir dos vírus, seria de se esperar que os genes de marca virótica essenciais à replicação do ADN - como os S3H e a primase do tipo virótico se fizessem presentes. Para os autores, tanto as células quanto os vírus de ADN seriam descendentes de um mundo de ADN que sucedeu o mundo de ARN e etapas intermediárias. Seu modelo de evolução dos sistemas genéticos envolve a replicação e competição de moléculas não dispersas em uma sopa, mas em soluções contidas em compartimentos inorgânicos intercomunicantes (como poros de uma rocha):
a) do Mundo de ARN teriam surgidos ribozimas egoístas que dariam origem aos íntrons do tipo I;
b) do Mundo de ARN-proteínas surgiriam os vírus de ARN de fita dupla;
c) do Mundo de ARN-ADN-retrotranscriptase, os retrons, íntrons do tipo II;
d) do Mundo de ADN, as células bacterianas, as arqueanas e os vírus de ADN.
A evolução dos capsídios teria ocorrido já nas fases pré-celulares: a vantagem seria a estabilidade e proteção do material genético dos ancestrais dos vírus e a facilitação do transporte entre os compartimentos. Por toda a evolução inicial, até a celularização, todo o sistema genético teria características virais: cada molécula de ARN e ADN atuaria como elemento egoísta, não havendo distinção entre elementos parasitas daqueles que dariam origem aos genomas das formas celulares. Essa distinção surgiria com o desenvolvimento de cooperativas egoístas - conjunto relativamente estável de elementos genéticos co-herdados. Nesse conjunto, em estágio posterior, genes codificadores de elementos de replicação e genes de funções acessórias passariam a ficar fisicamente ligados (possivelmente no estágio do Mundo de ADN, quando moléculas maiores poderiam ser mais precisamente replicadas); enquanto genes solitários ocupariam o nicho parasítico. Vírus eucarióticos surgiram da mistura de vírus bacterianos e vírus de arqueas quando a célula eucariótica surgiu da fusão de uma bactéria com uma arquea. A hipótese da fusão é defendida por Koonin et al. (2006) pelo fato de o genoma eucariótico apresentar similaridades com genoma de arqueas (especialmente os genes informacionais - responsáveis pela replicação, transcrição, reparo e tradução) e de bactérias (em particular, os genes operacionais, responsáveis pelo metabolismo celular e vias biossintéticas).

Forterre (2006) defende ainda a hipótese da eucariogênese viral, isto é, os vírus seriam os responsáveis pela emergência do núcleo eucariótico. Poxvírus têm um ciclo reprodutivo reminiscente a características do núcleo eucariótico: a polimerase de ADN e as enzimas de capeamento (capping) de ARNm são evolutivamente relacionadas às de eucariotos (embora formem um grupo monofilético viral); a transcrição inicial do ADN viral ocorre ainda no núcleo viral e o ARN resultante é passado ao citoplasma do hospedeiro por meio de poros; depois da liberação do núcleo viral, o ADN do vírus se organiza em um mininúcleo, recrutando a membrana do retículo endoplásmico do hospedeiro; o ADN do vírus só se replica após a formação do mininúcleo e este se desfaz com o término da replicação viral (em processo controlado por proteínas fosforilantes). Embora poxvírus tenham um genoma pequeno, os mimivírus têm um genoma (cerca de 1Mb) que é apenas a metade do tamanho dos menores genomas eucariotos, assim um vírus de ADN poderia ser um iniciador da eucariogênese. Claverie (2006) também defende a eucariogênese viral, com o genoma (de ARN) do hospedeiro gradualmente transferido para o núcleo. De início poderia ocorrer o caminho inverso: a viriogênese nuclear, com o núcleo deixando a célula e se tornando, ele mesmo, um agente infeccioso (algo similar ocorre no parasitismo de algas vermelhas); isso explicaria a diversidade de vírus de ADN em termos de tamanho do genoma, complexidade e composição genética - vários eventos independentes produziriam uma combinação particular de genes virais com os de hospedeiros. Para Witzany (2008), os telômeros são outra marca do processo de eucariogênese viral. Porém, como nota Forterre (2006), há bactérias com núcleos - os Planctomycetes -, não se sabe ainda se é uma estrutura homóloga à dos eucariotos, mas potencialmente pode fornecer um importante teste de hipótese à eucariogênese viral.

Forterre & Prangishvili (2009) apresentam uma outra hipótese para o envolvimento de vírus na eucariogênese em lugar da ação direta da infeção por um vírus gigante de ADN. A célula hospedeira - um protoeucarioto - teria recrutado os mecanismos virais produzindo sua própria membrana e poros nucleares, o que, em um primeiro momento, teria protegido seu material genético dos vírus (posteriormente várias linhagens virais desenvolveram a capacidade de penetrar o núcleo). A capacidade de formação de mininúcleo anteriormente descrita, por sua vez, teria surgido nos vírus (não apenas os vírus de ADN como vírus de ARN também são capazes de recrutar a membrana do retículo endoplásmico) de modo a protegê-los do sistema de defesa do hospedeiro.

A complexa parede celular bacteriana, especulam Forterre & Pragishvili (2009), poderia ter se originado em resposta à pressão seletiva de evitação de ataques virais - cujo principal modo de entrada é por meio da fusão com a membrana celular. Isso explicaria a relativa pequena diversidade viral entre as bactérias - em comparação a vírus de arqueas e eucariotos - e a predominância de vírus Caudovirales, ordem que desenvolveu um sistema de entrada com uma cauda proteica que penetra a parede e a membrana celulares e injeta o material genético no interior da célula hospedeira. Os Planctomycetes, bactérias cuja parede celular não possui peptidoglicanos, novamente podem servir de teste de hipótese ao se analisar os tipos de vírus que os infectam. Seguindo nessa linha, os autores imaginam que essa interação levando à seleção de mecanismos nos hospedeiros que evitassem a infeção por vírus também poderiam ter conduzido à divergência entre os domínios e entre as espécies dentro de cada domínio por ter como efeito colateral a redução da transferência lateral de genes.

Plasmídios de bactérias e de arqueas possivelmente têm origem viral. Mesmo o cromossomo dos indivíduos são muito parecidos com um grande plasmídio. Elementos móveis procarióticos: provírus, transposons, sequências de inserção, integrons e ilhas de patogenicidade provavelmente também são originados de vírus. Mecanismos como conjugação, restrição-modificação, toxina-antitoxina e outros devem ter surgidos, dizem Forterre & Pragishvili (2009), na interação entre vírus e os hospedeiros bacterianos e arqueas. A interação com outra população de vírus deve ter levado à organização distinta dos cromossomos eucarióticos, bem como ao conjunto diferente de elementos móveis (principalmente retroelementos).

De acordo com Forterre (2006), vírus teriam ainda um papel na evolução das mitocôndrias e cloroplastos. As mitocôndrias são derivadas de uma α-proteobactéria endossimbionte, mas a polimerase de ARN, a polimerase de ADN e a helicase codificadas em seu genoma não são homólogas aos correspondentes bacterianos. Suas sequências são mais similares às de elementos do bacteriovírus T3/T7. Proteínas homólogas a elas são codificadas pelo genoma de provírus crípticos presentes em proteobactérias. Aparentemente houve uma substituição não-homóloga na evolução da organela. (Existem exceções como o caso dos jakobídeos, com mitocôndrias com genoma mais similar a de bactérias.) Nos cloroplastos, tanto polimerases de ARN similares às bacterianas (cianobactérias) quanto às virais são utilizados - a sequência viral é resultado da duplicação do gene codificador da ARN mitocondrial. Essa substituição das proteínas informacionais se correlaciona com modificação nos mecanismos de replicação do ADN e na organização cromossômica dessas organelas.

Em eucariotos como mamíferos, cerca de 30% do genoma consiste de sequências intrônicas e 60% de regiões intergênicas lotadas de elementos móveis em variados estados de degradação; sendo íntrons e elementos móveis, segundo Koonin et al. (2006), relictos do Mundo de Vírus ancestral. Vírus endógenos e retroelementos ao se destacarem de uma porção do genoma e se inserirem em outra, alteram o padrão de expressão de genes (p.e., inativando uma região promotora ou inserindo uma nova onde se integra ao ADN do hospedeiro) e também podem criar novos genes (p.e., criando um novo sítio de edição - splicing - alternativo) (Forterre & Pragishvili 2009).

Harris (1991), com base na presença de retrovírus endógenos no citotrofoblasto da placenta, sugere que uma infecção viral na linhagem germinativa de um ancestral metatério pode ter levado ao desenvolvimento da placenta. Retrovírus são capazes de induzir a fusão celular tanto em tecidos cultivados quanto in vivo: glicoproteínas virais são sintetizadas pela célula hospedeira e, integrando-se à membrana, interagem com receptores de membrana de células vizinhas permitindo sua fusão. O trofoblasto se desenvolve normalmente em uma placa sincicial altamente invasiva (como um tumor), vacuolada e coberta de microvilosidades; após o parto, com o descarte da placenta, o sinciciotrofoblasto exibe sinais de degeneração com aglomeração nuclear e picnose. Esse padrão é muito similar ao sincício formando em células cultivada infectadas com retrovírus, bem como a certos tumores e tecidos em organismos com infecção retroviral.

Para Sasaki et al. (2008), elementos repetitivos intercalados curtos (SINE), em particular o lócus AS071 em camundogos, podem ter desempenhado um papel no desenvolvimento do cérebro em mamíferos. Manipulando experimentalmente o lócus AS071, os pesquisadores obtiveram uma expressão aumentada do gene FGF8 (fator de crescimento de fibroblasto 8) no diencéfalo e no hipotálamo.

Forterre & Prangishvili (2009) especulam "The principal difference between chimps and us is clearly the number, variety, and, more importantly, the integration loci of elements of viral origin in our genomes. The origin of humanity will certainly be viewed someday as a particular outcome of viral creativity." ["A principal diferença entre chimpanzés e nós são claramente o número, a variedade e, mais importante, os lócus de integração de elementos de origens virais em nosso genoma. A origem da humanidade certamente será vista um dia como um resultado particular da criatividade viral."]

Ou talvez, e é uma sugestão descaradamente especulativa, o Agente Smith, de um outro modo, estivesse certo, mais do que resultado da atividade viral, *somos* vírus.

Referências
Claverie JM (2006). Viruses take center stage in cellular evolution. Genome biology, 7 (6) PMID: 16787527
Forterre P (2006). The origin of viruses and their possible roles in major evolutionary transitions. Virus research, 117 (1), 5-16 PMID: 16476498
Forterre P, & Prangishvili D (2009). The great billion-year war between ribosome- and capsid-encoding organisms (cells and viruses) as the major source of evolutionary novelties. Annals of the New York Academy of Sciences, 1178, 65-77 PMID: 19845628
Harris, J. (1991). The evolution of placental mammals FEBS Letters, 295 (1-3), 3-4 DOI: 10.1016/0014-5793(91)81370-N
Koonin EV, Senkevich TG, & Dolja VV (2006). The ancient Virus World and evolution of cells. Biology Direct, 1 PMID: 16984643
Raoult D, & Forterre P (2008). Redefining viruses: lessons from Mimivirus. Nature reviews. Microbiology, 6 (4), 315-9 PMID: 18311164
Sasaki, T., Nishihara, H., Hirakawa, M., Fujimura, K., Tanaka, M., Kokubo, N., Kimura-Yoshida, C., Matsuo, I., Sumiyama, K., Saitou, N., Shimogori, T., & Okada, N. (2008). Possible involvement of SINEs in mammalian-specific brain formation Proceedings of the National Academy of Sciences, 105 (11), 4220-4225 DOI: 10.1073/pnas.0709398105
Wessner, D. R. (2010). The Origins of VirusesNature Education, 3 (9).
Witzany, G. (2008). The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance Biosemiotics, 1 (2), 191-206 DOI: 10.1007/s12304-008-9018-0

sexta-feira, 1 de junho de 2012

Resultado: Concurso Cultural GR "Get a Life"

A resposta do enigma do Concurso Cultural GR: Get a Life é:

Evolution is no linear family tree, but change in the single multidimensional being that has grown to cover the entire surface of Earth."**
["A evolução não uma árvore genealógica linear, mas a mudança de um único ser multidimensional que cresceu cobrindo toda a superfície da Terra."]

Os dígitos correspondem a letras em codificação ASCII. Fazendo a conversão temos: "GAGGUCUAGCUAUGAACCAUUUAGAAUAUAUCGAAUUAGCUAAUUAACGAAGCCAGAUUUGCU
AUGAUACUCUACACACGUGAGGAAQACUGAACGUGUCAUGCUAACGGGGAAAUUAAUACUCA
CGAAUCGAUAAAUGGUUUAGAAAUGUGACUAACAAUAGACAUAAUGGAGAAUUCCAUAUAGA
AUGCGCUAQACGAAAUCAACGGCACGCAUGCUACGCAUGCCAGCGGUCGGUAGUGGAACAAC
UAGUGGACGUAGUGUUAGGUGGAAAGGACCCAUGAGGAAAAUACCAUACGUGAAUCUUGAA
GGUUCGCAUGUGAAUAGUUUGAAGCACGAACCCACUAA".

Usando o código genético universal ou padrão, temos os aminoácidos em símbolos de uma letra:
"E V Stop L Stop T I Stop N I S N Stop L I N E A R F A Met I L Y T R E E X Stop T C H A N G E I N T H E S I N G L E Met Stop L T I D I Met E N S I Stop N A L X E I N G T H A T H A S G R Stop W N N Stop W T Stop C Stop V E R T H E E N T I R E S Stop R F A C E Stop F E A R T H Stop".

Já a partir disso é mais ou menos fácil deduzir a frase. Mas os códigos de parada também podem codificar aminoácidos especiais (modificações de aminoácidos comuns): selenocisteína e pirrolisina.

Tudo isso poderia ser feito tediosamente à mão. Mas algumas ferramentas online facilitam em muito o trabalho: um serviço de OCR converte imagens digitalizadas em textos; para converter binário em caracteres ASCII também há um site; e outra página traduz sequências de ADN e ARN em sequências de aminoácidos.

Mas vamos ao ganhador. Três pessoas acertaram, mas o que enviou a resposta correta por primeiro foi Piter Boll. Ele já foi contatado e o livro: "O que é Vida?" de Lynn Margulis e Dorion Sagan será enviado gratuitamente.*

Parabéns ao Boll e meus agradecimentos a todos os que participaram: seja tentando responder, seja divulgando o concurso.

*Upideite(08/jun/2012): Boll já recebeu o prêmio.
**Upideite(17/jun/2012): A frase original exata é: "Evolution is no linear family tree but change in the single, multidimensional being that has grown now to cover the entire surface of Earth.", no livro "What is Life?" de Lynn Margulis e Dorion Sagan.

LinkWithin

Related Posts with Thumbnails